, 2007). The RegSR system has long been known to activate the transcription of the nifA gene that encodes the key regulator for nitrogen-fixation

genes in B. japonicum (Bauer et al., 1998). Among the novel RegR target genes, we identified a putative operon (blr1515–blr1516) that encodes a predicted multidrug efflux system. Here, we report the characterization of a mutant lacking Apoptosis Compound high throughput screening this predicted transport system, now designated BdeAB, and demonstrate that it confers antibiotic resistance and is required for an efficient symbiosis specifically with soybean. Bradyrhizobium japonicum strains were routinely cultivated in a peptone–salts–yeast extract (PSY) medium supplemented with 1 g l−1l-arabinose as described elsewhere (Regensburger & Hennecke, 1983; Mesa et al., 2008). Alternatively, we used a modified Vincent’s minimal medium (Vincent, 1970; find protocol Becker et al., 2004) that was supplemented with 3 g l−1l-arabinose, 10 mM MOPS (final pH of medium adjusted to 6.8 with 2 M NH3), and trace elements as described elsewhere (Bishop et al., 1976). When appropriate, antibiotics were used at the following concentrations (μg ml−1): spectinomycin, 100; streptomycin, 50; tetracycline, 50 (solid media) or 25 (liquid media); and cycloheximide, 100. Bradyrhizobium japonicum strain 110spc4 was used as the wild type (Regensburger & Hennecke, 1983). Mutant

derivatives relevant for this work were strain 2426 (ΔregR∷Ω; Bauer et al., 1998); strain 9589 (ΔbdeAB∷Ω; see below); and strain 9589-38 (strain 9589 complemented with chromosomally inserted wild-type bdeAB genes; see below). Escherichia coli strains were grown in Luria–Bertani medium (Miller, 1972) containing the following concentrations of antibiotics for plasmid selection (μg ml−1): ampicillin, 200; streptomycin, 50; and tetracycline, 10. Strain DH5α (Bethesda Research Laboratories, Gaithersburg, MD) was the host for cloning, and S17-1 (Simon

et al., 1983) for the conjugation of plasmids into B. japonicum. Sterilization of seeds of soybean [Glycine max (L.) Merr. cv. Williams], cowpea (Vigna unguiculata), siratro (Macroptilium atropurpureum), and mungbean (Vigna radiata), plant growth conditions, and measurement of nitrogenase activity were performed as described previously (Göttfert et al., 1990; Gourion O-methylated flavonoid et al., 2009; Koch et al., 2010). At least 107 cells of B. japonicum were added as inoculum. For bacteroid isolation, all nodules from individual soybean plants infected by either the wild type or the ΔbdeAB strain 9589 were collected and weighed. Nodule material was then crushed in PSY medium, and serial dilutions of the bacteroid suspension were spotted in four parallels on PSY agar plates containing spectinomycin and cycloheximide. After a 1-week incubation at 30 °C, the number of CFU per milligram of nodule wet weight was determined.

Around 20 pieces of each section of root were examined for each of the five plants from each ecotype– soil combination (i.e. approximately 60 root pieces per plant). DNA was extracted from approximately 0.5 g freeze-dried and ground root material (one root system for each ecotype–soil combination) as described by Ward et al. (2005). Polymyxa-specific rDNA primers Pxfwd1 (5′-CTG CGG AAG GAT CAT TAG CGT T-3′) and Pxrev7 (5′-GAG GCA TGC TTC CGA GGG CTC T-3′) were used in PCR (Ward & Adams, 1998). Plasmodiophora-specific PCR was performed as

in Cao et al. (2007) using primers TC1F/TC1R. For sequencing PF-562271 order studies, the Polymyxa-specific forward primer Pxfwd1 and the generic fungal ITS4 reverse primer (5′-TCC TCC GCT TAT TGA TAT GC-3′) (White et al., 1990) were used to amplify rDNA. CX-5461 concentration Each reaction mix (50 μL) contained 0.2 μM primers, 1 U Taq DNA polymerase (MBI), 0.2 mM dNTPs (Sigma), 1 × PCR buffer NH4 (MBI) and 0.02 mg μL−1 bovine serum albumin. Cycling conditions were 2 min at

95 °C, and then 30 cycles of 94 °C for 30 s, 50 °C for 1 min and 72 °C for 2 min, followed by 72 °C for 10 min. Products were analysed in 1% agarose gels. PCR products were cloned into the pGEM®-T Easy vector (Promega Corporation, Madison, WI). Plasmid DNA was prepared using the QIAprep spin miniprep kit (Qiagen, Crawley, UK) and sequenced using the ABI PRISM™ Big-Dye version 1.1 kit using M13 sequencing primers and run at the Geneservice sequencing facility (http://www.geneservice.co.uk). ITS rDNA sequences were aligned by clustalx and manually adjusted. Phylogenetic analysis was performed using the neighbour-joining method (maximum composite likelihood distances) in mega4 (Tamura et al., 2007) with 10 000 bootstrap replications. Examination by microscopy showed the presence of Polymyxa-like spores in numerous root hairs (but not the main root) of all five Arabidopsis ecotype Ler-0 plants grown in the Woburn soil (Fig. 1). Two of the Col-0 plants grown in the Woburn soil contained structures that resembled Polymyxa zoosporangia (Fig.

2). Three of these structures were seen in total and they were all located in the main root system rather Methocarbamol than the root hairs. No spore clusters were observed. In the root sections examined from Arabidopsis plants grown in the Wiltshire soil, no clusters of Polymyxa-like resting spores or zoosporangia were identified. PCR with the Polymyxa-specific primers Pxfwd1/Pxrev7 demonstrated the presence of Polymyxa spp. in the roots of all four combinations of Arabidopsis ecotypes and soils (Fig. 3). Using a Plasmodiophora-specific PCR assay, we also demonstrated that Plasmodiophora was not present in these samples (Fig. 3). A total of 28 clones were sequenced following the amplification of rDNA products from Arabidopsis roots using primers Pxfwd1/ITS4.

Amplifications included 30 cycles (94 °C for 30 s, 58 °C for 1 min and 72 °C

for 2 min 30 s), followed by a final extension step at 72 °C for 10 min. Template S. Typhi and S. Typhimurium chromosomal DNA was prepared as described previously (Santiviago et al., 2001). Primers sopD21 (GTGTGGCTGTTCCAGAATGTGCTG) and sopD22 selleckchem (CCGTTGCTAAACTGCCGTTTGCTTA) were used to amplify a fragment of 1800 bp. For S. Typhimurium 14028s mutagenesis, primers sopD23W (ATGCCAGTTACGTTAAGTTTTGGTAATCGTCATAACTATGTGTAGGCTGGAGCTGCTTCG) and sopD24W (TATATAAGCATATTGCGACAACTCGACTTTTCACTTATACATATGAATATCCTCCTTAG) were used to amplify the aph- and cat-resistance cassette from pKD3 and pKD4, respectively (Datsenko screening assay & Wanner, 2000). Letters in italics highlight primer sequences that annealed with both resistance cassettes. All primers were designed on the basis of the reported sequence of S. Typhimurium LT2 sopD2 (AE006468.1). The sopD2 PCR product was cloned directly in the pCC1 vector according to the manufacturer’s instructions (CopyControl™ PCR Cloning Kit, Epicentre) to yield the plasmid pNT007. The presence of the gene and its promoter region in the plasmid was confirmed by PCR amplification and restriction

endonuclease analyses. The cloned PCR product was sequenced to ensure that it did not harbor any mutation (data not show). sopD2 pseudogene sequencing was performed by Macrogen Corp. (Rockville, MD) using S. Typhi chromosomal DNA prepared as described (Santiviago et al., 2001) and pNT007 Avelestat (AZD9668) previously isolated using the Wizard miniprep kit (Promega). To generate the chromosomal deletion of sopD2, a ‘one-step inactivation’ protocol was performed (Datsenko & Wanner, 2000). Following mutagenesis, aph- and cat-resistance cassettes were removed by FLP-mediated recombination. To measure bacterial invasion, the method described by Lissner et al. (1983) and modified by Contreras et al. (1997) was used. Briefly, HEp-2 monolayers were grown at 37 °C in a 5% CO2/95% air mixture in RPMIFS (RPMI medium supplemented with 10% fetal bovine serum pretreated for 30 min at 60 °C). Bacterial

strains were grown anaerobically to mid-exponential phase and then harvested by centrifugation before infection of the confluent HEp-2 monolayers in 96-well microtiter plates at a multiplicity of infection of 100 : 1. After incubation for 1 h to allow bacterial entry into cells, monolayers were washed twice with phosphate-buffered saline (PBS), and 100 μL of RPMI containing gentamicin (200 μg mL−1) was added to each well. The plates were then incubated for 2 h to kill any remaining extracellular bacteria. For strains carrying vectors, the medium was supplemented with chloramphenicol throughout the assay. The medium was removed and cells were washed twice with PBS. The cells were then lysed with sodium deoxycholate (0.5% w/v in PBS).

In conclusion, low CRF-R activation during lactation is an essential prerequisite for the adequate occurrence of maternal behaviour. “
“Neuropeptide

S (NPS) regulates various biological functions by selectively activating the NPS receptor (NPSR). Recently, epidemiological studies revealed an association between NPSR single nucleotide polymorphisms and susceptibility to panic disorders. Here we investigated the effects of NPS in mice subjected to the elevated T maze (ETM), an assay which has been proposed to model anxiety and panic. Diazepam [1 mg/kg, www.selleckchem.com/products/Staurosporine.html intraperitoneally (i.p.)] elicited clear anxiolytic effects reducing the latency to emerge from the closed to the open (CO) arm without modifying the latencies from the open to the closed (OC) arm. By contrast, chronic fluoxetine (10 mg/kg i.p., once a day for 21 days) selectively increased OC latency, suggesting a panicolytic-like effect. NPS given intracerebroventricularly at 0.001–1 nmol elicited both anxiolytic- and panicolytic-like effects. However, although the NPS anxiolytic dose–response curve displayed the classical sigmoidal shape, the dose–response HDAC inhibitor review curve of the putative panicolytic-like effect was bell shaped with

peak effect at 0.01 nmol. The behaviour of wild-type [NPSR(+/+)] and receptor knock out [NPSR(−/−)] mice in the ETM task was superimposable. NPS at 0.01 nmol elicited anxiolytic- and panicolytic-like effects in NPSR(+/+) but not in NPSR(−/−) mice. In conclusion, this study demonstrated that NPS, via selective activation of the NPSR, promotes both anxiolytic- and panicolytic-like actions in the mouse ETM. “
“The role for phosphorylated p38 mitogen-activated protein kinase [p-p38(MAPK)] in β-amyloid plaque deposition [a hallmark of Alzheimer’s

disease (AD) pathology] remains ambiguous. We combined immunohistochemistry and stereological sampling to quantify the distribution of plaques and p-p38(MAPK)-immunoreactive (IR) cells in the sensorimotor cortex of 3-, 6- and 10-month-old TgCRND8 mice. The PTK6 aggressive nature of the AD-related human amyloid-β protein precursor expressed in these mice was confirmed by the appearance of both dense-core (thioflavin-S-positive) and diffuse plaques, even in the youngest mice. p-p38(MAPK)-IR cells of the sensorimotor cortex were predominantly co-immunoreactive for the Macrophage-1 (CD11b/CD18) microglial marker. These p-p38(MAPK)-IR microglia were associated with both dense-core and diffuse plaques, but the expected age-dependent increase in the density of plaque-associated p-p38(MAPK)-IR microglia was restricted to dense-core plaques. Furthermore, the density of dense-core plaque-associated p-p38(MAPK)-IR microglia was inversely correlated with the size of the core within the given plaque, which supports a role for these microglia in restricting core growth.

A meta-analysis could not be performed because of the heterogeneity of trials. In total, 21 trials fulfilled all inclusion criteria. Of 21 trials, only one that examined motivational

interviewing for alcohol-dependent patients showed statistically significant results for adherence rates and viral load in favour of the intervention. One trial showed a statistically significant clinical effect of the intervention; however, inconsistent results were presented for adherence depending on the underlying adherence definition. The results of the remaining 19 trials were not statistically significant or were conflicting for adherence and/or clinical outcomes. However, the methodological trial quality was low. It is not possible to definitively assess the effectiveness of adherence-enhancing interventions. However, it appears that most adherence interventions have no effect. selleck products “
“Mortality in young people with perinatally acquired HIV infection (PHIV) following transfer to adult care has not been characterized in the UK. We conducted a multicentre audit to establish the number of deaths and associated factors. Fourteen adult clinics caring for infected young

people reported deaths to 30 September 2011 on a proforma. Deaths were matched PLX3397 to the Collaborative HIV Paediatric Study, a clinical database of HIV-infected children in the UK/Ireland, to describe clinical characteristics in paediatric care of those who died post-transition. Eleven deaths were reported from 14 clinics which cared for 248 adults with PHIV. For the 11 deaths, the median age at transfer to adult care was 17 years (range 15–21 years), and at death

was 21 years (range 17–24 years). Causes of death were suicide (two patients), advanced HIV disease (seven patients) and bronchiectasis (one patient), with one cause missing. At death, the median CD4 count was 27 cells/μL (range 0–630 cells/μL); five patients were on antiretroviral therapy (ART) but only two had a viral load < 50 HIV-1 RNA copies/mL. Nine had poor adherence when in paediatric care, continuing Atorvastatin into adult care despite multidisciplinary support. Eight had ART resistance, although all had potentially suppressive regimens available. Nine had mental health diagnoses. Our findings highlight the complex medical and psychosocial issues faced by some adults with PHIV, with nine of the 11 deaths in our study being associated with poor adherence and advanced HIV disease. Novel adherence interventions and mental health support are required for this vulnerable cohort. “
“One-half of the estimated 2.5 million people who now live with HIV in the World Health Organization (WHO) European Region are still diagnosed late. A central question is which clinical scenarios should trigger an HIV test recommendation in order to avoid late presentation.

The RO4929097 order methoxymalonyl-ACP biosynthesis locus, which is composed of fkbGHIJK, was first reported in the FK520 biosynthetic gene cluster (Wu et al., 2000). The roles of fkbGHIJK orthologs in the biosynthesis of methoxymalonyl-ACP

were then substantiated by genetic and biochemical experiments (Fig. 1b) (Kato et al., 2002; Chan et al., 2006; Dorrestein et al., 2006). The methoxymalonyl-ACP biosynthesis locus is generally colocalized with the related modular PKS gene cluster. In the present study, a gene disruption experiment establishes that a methoxymalonyl-ACP biosynthesis locus (galGHIJK) is involved in the biosynthesis of galbonolide A in S. galbus. It is also shown that orf4, which is proximal to galGHIJK and contains a KAS domain, is involved in the biosynthesis of galbonolides A and B. Notably, there is no multimodular PKS gene cluster flanking Enzalutamide in vivo these loci, however. Streptomyces galbus KCCM 41354 was acquired from the Korean Culture Center of Microorganisms. Escherichia coli DH5α was used as the host for general subcloning. For total DNA isolation, S. galbus was grown in tryptic soy broth with 10 mM MgCl2·6H2O and 0.5% w/v glycine. Glucose–yeast extract–malt extract (GYM) agar was used for S. galbus spore preparation. Escherichia

coli ET12567 (dam−, dcm−, hsdS−)/pUZ8002 was the nonmethylating plasmid donor strain for the intergeneric conjugative transfer to S. galbus (Flett et al., 1997). GYM agar supplemented with 10 mM MgCl2 was used for the conjugation experiment. Genetic procedures including the gene disruption Silibinin experiment were performed using standard procedures (Kieser et al., 2000). Southern hybridization

was performed with digoxigenin DNA labeling and a detection kit from Roche Diagnostics (Pleasanton, CA) by following the procedure outlined by the manufacturer. An 800-bp DNA fragment of an fkbI homologue was amplified from the S. galbus chromosome using the PCR and the primer set of 5′-CAGGGCATGGCCGCSTG GACSGT-3′ and 5′-GATGATCTCCATSAGCTTSGCRTC-3′ (Li et al., 2006), which was then cloned into the pGEM-T Easy vector (Promega, Madison, WI). This DNA clone was named pHJK1001. A cosmid library of S. galbus KCCM 41354 genomic DNA was constructed using SuperCos I and the Gigapack III Gold packaging extract kit according to the manufacturer’s handbook (Stratagene, La Jolla, CA). A 3.2-kb KpnI DNA fragment was isolated from the S. galbus genome using the 800-bp fragment in pHJK1001 as a probe, and the presence of methoxymalonyl-ACP biosynthetic genes (galGHI and a truncated galJ) was confirmed by nucleotide sequencing. The 3.2-kb KpnI DNA fragment was then used as a probe in screening the cosmid library, which resulted in the isolation of a positive clone pHJK1011. The 800-bp fragment internal to galI was isolated as an EcoRI fragment from pHJK1001 and ligated into pKC1139 to generate pD-galI, a galI-disruption plasmid. The conjugative plasmid pKC1139 contains an E.

67 package (http://evolution.genetics.washington.edu/phylip.html). The final tree was edited using dendroscope 2 (Huson et al., 2007). The A3 and A7 motifs of the NRPS adenylation domain are highly conserved and suitable for degenerate primer design (Tanaka et al., 2005; Wei et al., 2005; Johnson et al., 2007). A pair of degenerate primers was designed based on these sequences (Table S1). They amplified a 271-bp fragment from the genomic DNA of strain 1630 and an 858-bp fragment from strain DSM 1153. The primers

targeting the KS domain of the PKS coding genes developed by Keller et al. (1995) amplified a 498-bp fragment from strain 1630 and a 760-bp fragment from strain DSM 1153. The 271-bp fragment was located on a 3.8-kb open reading frame designated as nrps1 (Fig. 1a). This sequence turned out to be on the T domain, whereas the expected fragment of 671 bp on the A domain was only weakly amplified under this website our PCR conditions. The putative 138 kD NRPS1 protein

showed 32% similarity to LPS2, a subunit of the ergopeptine synthetase enzyme complex in Claviceps purpurea (Correia et al., 2003), and 30% similarity to LpsB for ergovaline biosynthesis in Neotyphodium lolii (Fleetwood et al., 2007). The completely different genetic contexts surrounding nrps1 compared with the genes of these ergot alkaloid synthetases reemphasizes that NRPS1 most likely produces a molecule unrelated to ergot alkaloids (Fig. 1b). Cordyceps militaris belongs to the same Clavicipitaceae family as Claviceps purpurea and N. lolii, but C. militaris strain Enzalutamide concentration ATCC 26848 does not produce any ergopeptines, and a gene encoding

LPS1, another protein in ergopeptine biosynthesis, was not detected in strain ATCC 26848 (Panaccione et al., 2001). The 858-bp fragment was located on a 6.9-kb NRPS coding gene in the strain DSM 1153 genome (Fig. 2a). The gene was named etplP for epipolythiodioxopiperazine (ETP)-like peptide synthetase because many of its surrounding genes showed similarities to genes in the ETP biosynthetic pathway in Leptosphaeria maculans and Aspergillus Resminostat fumigatus (Fig. 2b). ETP biosynthetic gene clusters are common in Ascomycetes (Patron et al., 2007; Fox & Howlett, 2008) and at least 14 different ETPs from 15 different producing organisms have been predicted (Gardiner et al., 2005). EtplP showed 41% sequence homology to SirP, which is involved in sirodesmin PL production in L. maculans (Gardiner et al., 2004), and 28% homology to GliP, which is involved in gliotoxin production in A. fumigatus (Gardiner & Howlett, 2005). The 498-bp fragment from strain 1630 was on a 7.5-kb PKS coding gene that showed homology to two genes involved in lovastatin biosynthesis in Aspergillus terreus, i.e. lovB [encoding the lovastatin nonaketide synthetase (LNKS)] and lovF [encoding the lovastatin diketide synthetase (LDKS)] (Hendrickson et al., 1999; Kennedy et al., 1999) (Fig. 3a).

, 2011). We note that defective frontal functioning is also observed after sleep deprivation. This paper and the companion article (Rolls et al., 2003) thus serve to provide preliminary baseline observations and data for more detailed sleep studies of this important PFC region in monkey and humans (Vogt, 2009; Teffer & Semendeferi, 2012). The

investigations also provide unique data on the firing rates of mPFC selleck chemicals llc neurons during wakefulness, drowsiness and sleep. In summary, we have shown that in many areas of the primate mPFC, there is a significant population of neurons (about 28% of the sampled cells) that significantly increase their firing rates during periods of inattention and eye-closure. The firing rates of this set of mPFC neurons (Type 1 cells) averaged 3.1 spikes/s when

awake, and 10.2 spikes/s in the eyes-closed and drowsy state. Such neurons may be part of an interconnected network of distributed brain regions that are more active at rest than during tasks requiring attention. In humans and monkeys, these areas are part of the anterior default mode network, defined by increased activation in functional neuroimaging studies during the resting state (Raichle et al., 2001). The novel findings reported here provide direct electrophysiological evidence that many single neurons in these areas of mPFC significantly increase their firing rates during periods of eye-closure and DAPT in vivo rest. We acknowledge, with gratitude, the help and support of Andrew Healey (Imperial College, London), Justus Verhagen (J B Pierce Lab, Yale University), Miki Kadohisa (Oxford University) and Payam Rezaie (The Open University, Milton Keynes). This project was supported by grants from the MRC (UK) to E.T.R. Abbreviations BA Brodmann area fMRI functional magnetic resonance imaging mPFC medial prefrontal cortex REM rapid eye movement SWS slow wave

sleep “
“The free-running circadian period is approximately 30 min shorter in adult male than in adult female Octodon degus. The sex difference emerges after puberty, resulting from a shortened free-running circadian period in males. Castration before puberty prevents the emergence Montelukast Sodium of the sex difference, but it is not a function of circulating gonadal hormones as such, because castration later in life does not affect free-running circadian period. The aim of this study was to determine whether or not the shortening of the free-running circadian period in male degus results from exposure to gonadal hormones after puberty. We hypothesized that masculinization of the circadian period results from an organizational effect of androgen exposure during a post-pubertal sensitive period.

, 2011). We note that defective frontal functioning is also observed after sleep deprivation. This paper and the companion article (Rolls et al., 2003) thus serve to provide preliminary baseline observations and data for more detailed sleep studies of this important PFC region in monkey and humans (Vogt, 2009; Teffer & Semendeferi, 2012). The

investigations also provide unique data on the firing rates of mPFC SB431542 in vivo neurons during wakefulness, drowsiness and sleep. In summary, we have shown that in many areas of the primate mPFC, there is a significant population of neurons (about 28% of the sampled cells) that significantly increase their firing rates during periods of inattention and eye-closure. The firing rates of this set of mPFC neurons (Type 1 cells) averaged 3.1 spikes/s when

awake, and 10.2 spikes/s in the eyes-closed and drowsy state. Such neurons may be part of an interconnected network of distributed brain regions that are more active at rest than during tasks requiring attention. In humans and monkeys, these areas are part of the anterior default mode network, defined by increased activation in functional neuroimaging studies during the resting state (Raichle et al., 2001). The novel findings reported here provide direct electrophysiological evidence that many single neurons in these areas of mPFC significantly increase their firing rates during periods of eye-closure and Ruxolitinib rest. We acknowledge, with gratitude, the help and support of Andrew Healey (Imperial College, London), Justus Verhagen (J B Pierce Lab, Yale University), Miki Kadohisa (Oxford University) and Payam Rezaie (The Open University, Milton Keynes). This project was supported by grants from the MRC (UK) to E.T.R. Abbreviations BA Brodmann area fMRI functional magnetic resonance imaging mPFC medial prefrontal cortex REM rapid eye movement SWS slow wave

sleep “
“The free-running circadian period is approximately 30 min shorter in adult male than in adult female Octodon degus. The sex difference emerges after puberty, resulting from a shortened free-running circadian period in males. Castration before puberty prevents the emergence Nintedanib (BIBF 1120) of the sex difference, but it is not a function of circulating gonadal hormones as such, because castration later in life does not affect free-running circadian period. The aim of this study was to determine whether or not the shortening of the free-running circadian period in male degus results from exposure to gonadal hormones after puberty. We hypothesized that masculinization of the circadian period results from an organizational effect of androgen exposure during a post-pubertal sensitive period.

Interviews were conducted following the experiential

training and 4–6 months after the workshop. Results  Enrolment for the complete multi stage course was limited to 12 pharmacists, while PD0332991 another 59 completed the course to the end of the workshop. Pharmacists completing the entire course had improved knowledge scores following the workshop, and between the workshop and 3-day experiential. These scores declined at 4–6 months. Improvements in confidence occurred throughout the course. At the final interview, all pharmacists indicated a positive impact on their practice. Mentorship was feasible and imperative to offer security to facilitate practice change. Conclusions  Overall, this comprehensive multi stage course improved knowledge, confidence and practice for pharmacists. “
“The study

aims to evaluate factors influencing pharmacists’ management of eye infections following the reclassification of ophthalmic chloramphenicol to pharmacist supply. Data were collected using a self-administered questionnaire posted to a random sample of community pharmacies in urban and rural areas in Western Australia. Data were entered into Excel and analysed using SPSS v17 (SPSS Inc., Chicago, IL, USA) and SAS v9.2 (SAS Institute Inc., Cary, NC, USA). Descriptive statistics were used to summarise the responses and ABT888 demographics of respondents. Regression analysis was used to identify relationships between variables. Factor analysis was conducted to pool variables and the derived factors were subjected to regression analysis. Of the 240 community pharmacies surveyed, 119 (49.5%) responded (79% urban and 21% rural pharmacies). Urban and rural pharmacies provided ophthalmic chloramphenicol over-the-counter (OTC) 3–4 and 1–2 times weekly, respectively (P = 0.021), with some pharmacies providing 12

or more per week. Over 82% of respondents claimed that sales of other OTC products used for acute bacterial conjunctivitis had ‘decreased/decreased markedly’. A majority of respondents (59%) claimed that there was no change in the number of prescriptions received for ophthalmic chloramphenicol. Most respondents (76.4%) 3-mercaptopyruvate sulfurtransferase agreed/strongly agreed that pharmacist’s current level of training was adequate to provide ophthalmic chloramphenicol. However, approximately one-fifth (21.8%) responded that pharmacists required some additional training. Down-scheduling of ophthalmic chloramphenicol has improved pharmacists’ capability to treat acute bacterial conjunctivitis, largely as a replacement for products previously available OTC, rather than fewer general practitioner consultations. Pharmacists showed overall support for the reclassification as it enabled better use of professional skills and patient access to improved treatment options. “
“Objectives  Pharmacy practice increasingly revolves around obtaining and interpreting information.