The detailed microstructures of the Co3O4 nanosheets were characterized with TEM. Figure 1b represents typical TEM images of Co3O4 nanosheets. The HRTEM

image shown in the inset of Figure 1b clearly demonstrates lattice fringes with a d-spacing of 0.46 nm (111), matching well with the XRD pattern. To further elucidate find more the composition, energy-dispersive X-ray spectroscopy was used to determine the nominal stoichiometric atomic ratio of Co and O, as shown in Figure 1c. The chemical composition of the film was investigated by XPS analysis. The spectra (Co 2p and O 1s, as shown in Figure 2) were acquired and processed using standard XPS peak fitting. Two peaks at binding energies of 780 and 795.1 eV were observed from the Co 2p spectra. The tetrahedral Co2+ and octahedral Co3+ contributed to the spin-orbit doublet 2p spectral profile of Co3O4[21]. The relatively sharp peak widths correspond to 2p 1/2 to 2p 3/2 with separation of 15.1 eV, and the weak satellite structure found in the high binding energy side of 2p 3/2 and 2p l/2 transitions

indicate the co-existence of Co(II) and Co(III) on the surface of the material. The Co 2p spectrum is well consistent with the XPS spectrum of Co3O4[22–24]. Figure 2 Co 2 p (a) and O 1 s (b) XPS spectra of Co 3 O 4 sample. The O 1s spectra of the sample was also presented in the inset of the same figure The peak at around 530 eV is due to lattice O, while the peak at about 531.6 eV can be attributed to the low coordinated oxygen ions (chemisorbed oxygen) at the surface [25]. Figure LY2835219 solubility dmso 3a presents the typical current–voltage (I-V) characteristics of RRAM cell with the Au/Co3O4/ITO

structure, measured by sweeping voltage, at a speed of 1 V/s, in the sequence of 0 → 2 → 0 → −2 → 0 V. During the measurements, the bias voltages were applied to the gold top electrode with ITO bottom electrode about as ground. By steady increase of the positive voltages imposed on the RRAM cell, a pronounced change of resistance from the high-resistance state (HRS/OFF) to the low-resistance state (LRS/ON) was observed at about 1.05 V, which is called as the SET’ process, and then the device was set in threshold switching mode (no change in current after this voltage). Figure 3 RS properties of the Au/Co 3 O 4 /ITO memory cells. (a) Typical bipolar resistance switching I-V curves of the Au/Co3O4/ITO cells. (b) Electrical pulse-induced resistance switching of the Au/Co3O4/ITO memory cell at room temperature for 60 s, (inset, data retention of Au/Co3O4/ITO memory cell for >104 s), and (c) I-V curves on log scale. Subsequently, an opposite ‘RESET’ process could also be cited, with the voltage sweep to negative values check details bringing the device first to an intermediate switching state at −1.53 V that increased up to −1.93 V and, after that, completely to OFF state. The sample exhibits a typical bipolar nature of resistive switching.

The Fas gene was subcloned to pAdTrack-CMV plasmid (a gift from Gang Huang, Third Military Medical University, Chongqing, China) and recombinants of pAdTrack-CMV-Fas www.selleckchem.com/products/srt2104-gsk2245840.html were generated by transformation the shuttle plasmid linearized with Pme I to BJ5183 cells with the adenoviruses backbone plasmid for homologous

recombination. The recombinant adenoviruses were packaged and propagated in 293 cells. Viral titers were determined by standard plaque assay after the Fas adenoviruses concentrated by CsCl ultracentrifugation using a standard method [17]. H446/CDDP cells were Selleckchem Rabusertib transfected with 50 multiplicity of infection (MOI) of adenoviruses in serum free RPMI and maintained in complete medium at 37°C until post-transfection day 3. The transfectants overexpressing Fas were obtained and designated as H446/CDDP/Fas. H446/CDDP cells transfected with empty adenoviruses were indicated as H446/CDDP/Empty and used as negative control in all assays. Conventional RT-PCR analysis On post-transfection day 3, total RNAs were isolated from H446/CDDP, H446/CDDP/empty, www.selleckchem.com/products/Y-27632.html and H446/CDDP/Fas cells using TRIzol reagent (TianGen, Beijing, China) and subsequently used for semiquantitative PCR. RT was performed with 1 μg of total RNA from each sample using oligo(dT) 18 primers and 200 units of SuperScript II RT (Life Technologies Inc., Gaithersburg, Md., USA) for cDNA synthesis. cDNA amplification was conducted in 20 μl solution

containing

2 μl of diluted cDNA, 10 pmol primer pairs for Fas, GST-π, ERCC1 and GAPDH, respectively, and 10 μl of Taq PCR Master mix (TianGen, Beijing, China). The PCR consisted of initial denaturation at 94°C for 5 min, followed by 30 reaction cycles (30 seconds at 94°C, 30 seconds at 61°C, and 30 seconds at 72°C) and a final cycle at 72°C for 10 min. Primers used in PCR were listed in Table 1. GAPDH was used as internal control. All PCR products were electrophoretically separated on ethidium bromide-stained agarose gel and visualized with UV light. Table 1 PCR primer sequences and product sizes. Primersa Oligonucleotide Sequences Product Size (bp) PCR Cycles Fas F: 5′GTCCAAAAGTGTTAATGCCCAAGT 3′ 232 30   R: 5′ATGGGCTTTGTCTGTGTACTCCT 3′     GST-π F: 5′ CCGCCCTACACCGTGGTCTAT 3′ 260 30   R: 5′ GCTGCCTCCTGCTGGTCCTT 3′     ERCC1-2 F: 5′ ACGCCGAATATGCCATCTCAC Ceramide glucosyltransferase 3′ 292 30   R: 5′ AGCCGCCCATGGATGTAGTCT 3′     GAPDH F: 5′ ACCCATCACCATCTTCCAGGAG 3′ 159 30   R: 5′ GAAGGGGCGGAGATGATGAC 3′     a All primers were designed using genetool software. Real-time quantitative PCR (RT-qPCR) RT-qPCR was performed with ABI 7500 Thermal Cycler and SYBR Green qPCR kit (Toyobo, Japan). PCR reactions were prepared in low-profile microplates with each well containing 10 μl of master mix, 2 μl of diluted cDNA, 10 pmol each of primers listed in Table 1 for Fas, GST-π, ERCC1 and control GAPDH, respectively, in a 20 μl reaction volume.

With novel ESTs, pig data were matched against the human genomic and transcript database

to confirm that the best matches were Citarinostat chemical structure to orthologous sequences. Hits were considered to be reliable if there was a putatively orthologous match of 60-70 bp, and oligonucleotides with fewer matches, in the range of 50-59 bp, were also selected if p-values were significant in this study. Probe sets that could not be verified by BLAST as described above are not reported in this paper. Analysis of the signal intensity distribution of the cross-species hybridizations for both the lung and brain experiments showed a normal distribution similar to that obtained when homologous human RNA is hybridized to the chip. The proportion of the approximately 23K probes showing a signal greater than 100 signal value (i.e. above background) in the cross-hybridization is 22,300 from the 22,800 probes on the chip (~97%). The microarray data (accession number E-MEXP-2376) is available through ArrayExpress. Functional annotation of gene expression data In order to understand the biological phenomena studied here and reduce the interpretive challenge that is posed by a long list of differentially Emricasan expressed genes. Onto-Express was used to classify our lists of differentially

regulated genes into functional profiles characterizing the impact of the infection on the two different tissues http://​vortex.​cs.​wayne.​edu/​ontoexpress/​[14]. Initial analysis used the non-filtered dataset, i.e., all differentially regulated probe sets against the full human oligonucleotide geneset. We then looked at differentially expressed probes (p-value < 0.01) identified LY2090314 mouse from our microarray analysis, and statistical significance values were calculated for each category using the binomial test available in Onto-Express[15]. Dolichyl-phosphate-mannose-protein mannosyltransferase This makes no assumptions about those probesets with good matches to known pig sequences. However, only those probesets for which we could confidently assume orthology are reported

in the tables in this paper. Here we present categories of gene ontology based on a maximum pairwise p-value of 0.05 for the “”biological processes”". To gain a better understanding of the gene interactions (pathways) involved in the disease, Pathway-Express was also applied to our data. In order to quantify the over/under representation of each category, the library composition has been taken into account in the presentation of the results. Quantitative RNA analyses using real-time PCR methodology (qRT-PCR) Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) analysis using SYBR green and selected primers was carried out following the manufacturer’s protocol (QIAGEN, QuantiTect SYBR Green RT-PCR) to confirm the microarray results. All probes and primers were designed using Express Primer 3 software developed by the Whitehead Institute for Biomedical Research.

[41]. Aliquots of each RNA sample (2 μl)

were used to synthesise cDNA using a SuperScript III First Strand Synthesis System (Invitrogen). Primer pairs were designed using OligoTech Software (Additional File 3). Gene expression was assayed using the iCycler iQ, Multicolor Real-Time PCR Detection System (Bio-Rad) and iQ SYBR Green Supermix kit (Bio-Rad). Reaction conditions (20 μl volumes) were optimized by changing the primer concentration and annealing temperature to minimise primer-dimer formation and increase PCR efficiency. The following PCR profile was used: 2 min at 95°C, (95°C for 20 s, 60-63°C for 20 s, 72°C for 20 s) × 45, and 1 min at 72°C followed by recording of a melting curve. The absence of primer-dimers or accumulation of nonspecific products was checked by PCI-34051 melting-curve analysis. Each run included standard dilutions Crenolanib and negative reaction controls. The expression levels of each gene of interest and of the 18 S rRNA, which was chosen as a housekeeping

gene, were determined in parallel for each sample. Results were expressed as the ratio of the mRNA level of for each gene of interest normalised over housekeeping gene using the difference between threshold cycle values or ΔΔCt method [42, 43]. Ct values for individual target genes were calculated and the ΔCt average for the housekeeping gene was treated find more as an arbitrary constant and used to calculate ΔΔCt values for all samples. The mean fold induction for the three independent pools for each target gene was determined and the standard error of the mean was calculated. The list of primers used for the real-time PCR analysis is presented in Additional File 3. Acknowledgements The work was supported by grants from the Iranian Witches’ Broom Disease of Lime Network

(IWBDLN) and the Agricultural Biotechnology Research Institute of Iran. Electronic supplementary material Additional File 1: Agarose gel electrophoresis of nested PCR product from Mexican lime tree infected by “” Ca . Phytoplasma aurantifolia”" and from healthy plants. (DOC) Additional File 2: Primer sequences used for cDNA AFLP analysis. (DOC) Additional File 3: Primer sequences used for Real-Time PCR analysis. Gefitinib purchase (DOC 35 KB) References 1. Zreik L, Carle P, Bove JM, Garnier M: Characterization of the Mycoplasmalike Organism Associated with Witches-Broom Disease of Lime and Proposition of a Candidatus Taxon for the Organism, Candidatus-Phytoplasma-Aurantifolia. International Journal of Systematic Bacteriology 1995, 45 (3) : 449–453.PubMedCrossRef 2. Cimerman A, Arnaud G, Foissac X: Stolbur phytoplasma genome survey achieved using a suppression subtractive hybridization approach with high specificity. Applied and Environmental Microbiology 2006, 72 (5) : 3274–3283.PubMedCrossRef 3.

coli SM10λpir[16], mated into S. oneidensis MR-1 [9], and Gmr/Tcr single crossover recombinants were isolated. Following growth in LB liquid without selection, cultures of these single crossovers were plated to LB plates containing Gm, 5% sucrose (w/v), and 0.1% NaCl (instead of omiting NaCl to increase the likelihood of isolating an hfq mutant in the event that loss of hfq resulted in cells sensitive to hypoosmotic conditions). Gmr Sucr Tcs hfq∆ mutant candidates were screened via PCR and DNA sequencing of the disrupted region. The sequence of the primers used for diagnostic PCR in Figure

1 are as follows: A (hfq 5’ diagnostic) – ATAATGTGGTGCAATTTGCC; B (lacZ 5’ out) – CGTTGTAAAACGACGGGATCG; C (aacC1 3’out) – GATGCACTTTGATATCGACCC; D (hfq 3’ diagnostic) – GAGTCCAACCACGCACTAGG. Figure 1 Construction and verification of a null allele of the Shewanella oneidensis MR-1 hfq gene. (A) Knockout strategy for the MR-1 hfq gene. buy GSK1120212 Most of the hfq gene coding sequence (all but the first 9 codons and last 6 codons) was replaced with a cassette containing a promoterless lacZ gene and a Selleck BVD-523 gentamicin resistance marker. (B) Agarose gel of analytical PCR reactions using wild

type MR-1 (lanes www.selleckchem.com/products/XAV-939.html 2–4) or hfq∆ mutant (lanes 5–7) templates and primers A, B, C, and D (see Materials and Methods for primer sequences) indicated with arrows on the diagram in panel (A) The size standard (M) in lane 1 is 1kb plus DNA ladder (Invitrogen). (C) Western blot of SDS-PAGE-fractionated total protein from various Shewanella strains probed with a polyclonal antibody raised against E. coli Hfq protein. Lanes 1 and 2: MR-1 containing pBBR1-MCS-2 (vector) or hfq rescue construct (phfq), respectively. Lanes 3 and 4: hfq∆ containing vector or phfq, respectively. The antibody detects both putative Hfq monomers (~10kDa)

as well as putative Hfq homohexamers (~60kDa). To generate an hfq rescue construct, we PCR amplified a 1.3kb genomic fragment containing the S. oneidensis MR-1 hfq coding sequence and ~1kb upstream of the hfq open reading frame. Based on hfq promoter analysis in E. coli, this fragment likely contains the native promoters for filipin S. oneidensis hfq[17]. A PCR product was generated using the 5’ primer GGCAAGCTTCAGGAAAAACGGCTTTAGCTCTCG and the 3’ primer GGCGGTACCACTAAACCTTATTCGCCACTTGGC. Following restriction with HindIII and KpnI, this PCR product was ligated to HindIII/KpnI restricted pBBR-1MCS2 [18]. The resulting plasmid, pBBR1-hfq, was transformed into E. coli S17-1λpir[19] and mated into S. oneidensis strains. In our hands, the pBBR1-MCS2 based vectors were stably maintained in S. oneidensis strains after 30 hours in LB Km cultures and after 120 hours in modified M1 Km cultures (data not shown). Western blot analyses 3ml aliquots of S. oneidensis cultures were pelleted in a microcentrifuge for 2’ at 20300 x g.

As reactor effluents contain a dense and active microbiota, bacterial

fermentation and pH reduction can occur during intestinal cell incubation which can negatively affect cell viability thus epithelial integrity [23]. Salmonella invasion is influenced by environmental factors such as pH or SCFA concentrations. Upon infection Salmonella invasion was generally higher in distal reactors (pH 6.7) compared to proximal (pH 5.7) and transverse (pH 6.2) reactors and inversely related to SCFA concentrations. These results are consistent with findings of Durant et al. [32], demonstrating that Salmonella entry into HEp-2 cells was higher at pH 7 compared to pH 6 in the presence of 80 mM Veliparib ic50 acetate, 40 mM Ro 61-8048 propionate and 20 mM butyrate. A lower percentage of cell-association and invasion was observed as the concentration of each SCFA increased at pH 6 but not at pH 7 [32]. Salmonella invasion into intestinal cells is known to be associated with a rapid disruption of epithelial integrity caused by structural modifications of intercellular junctions that can be assessed by TER measurements [8, 33, 34]. In this study, we effectively demonstrated that effluents obtained from three-stage in vitro colonic fermentation models of Salmonella infection and applied directly on confluent and fully differentiated HT29-MTX cells induces a large and significant decrease of TER after 1 h of incubation, compared to non-infected effluents (Figure

3). Visualization of tight junctions by phalloidin staining revealed that intracellular junctions of HT29-MTX cells were not affected by the gut microbiota produced during initial model stabilization (Stab, Figure 4A) but were check details highly disrupted in the presence of Salmonella (Sal, Figure 4B). This is in accordance PRKD3 with results published by Jepson et al. [35] where incubation of MDCK monolayers with S. typhimurium SL1344 for 60 min was accompanied by a disruption of intracellular junctions. Addition of E. coli L1000 enhanced Salmonella growth in all reactors although the efficiency of Salmonella in invading HT29-MTX cells significantly decreased in distal reactor

(R3) samples. After the addition of B. thermophilum RBL67, the invasion efficiency of Salmonella decreased most in proximal reactors (R1), despite higher Salmonella counts compared to previous Ecol II periods. These results may reflect the influence of environmental requirements for optimal growth of the tested probiotics. B. thermophilum RBL67 is acid tolerant and a competitive bacteriocinogenic bacteria [15, 18], a trait likely advantageous for competing with other members of the bacterial ecosystem present in proximal colon reactors at pH 5.7. Indeed, B. thermophilum RBL67 best colonized and reduced Salmonella invasion into HT29-MTX cells at pH 5.7 with proximal reactor samples, while E. coli L1000 was more competitive at pH 6.6 in distal colon reactors. The presence of E.

Methods Specimens and species The MLST database [13] contained 378 Capmatinib clinical trial sequences from clinical specimens or bacterial isolates (July 2009), of which 199 were from Sweden and the remaining 179 from Europe, Africa, North America and Australia. The strains included in the analysis are listed in additional file 1: appendix 1. The last 121 bp of the hctB gene are excluded from the MLST analysis. Consequently, additional sequencing was performed as previously described XMU-MP-1 cost [11] but with the reverse primer hctB_R1 (5′-ATTTCGACTCAGCCAATAAATACA-3′). Sequences covering the hctB gene were aligned with ClustalW with default values in the BioEdit 7.0 sequence

alignment editor (Ibis Therapeutics, Carlsbad, CA). The repetitive elements were aligned based on homology according to neighbour-joining selleck chemicals llc phylogenetic analysis of the different types of repeat element. Obtained sequence variants were submitted to GenBank and the accession numbers are listed in additional file 2: appendix 2. Accession numbers for Hc2 in other Chlamydiales and Hc2-like proteins in other genera are listed in additional file 3: appendix 3. Sequence analysis Repetitive amino acid elements were found with Dottup plots using a word size of 20 and Pepinfo

was used to create plots that show the charge distribution. Both Dottup and Pepinfo are part of EMBOSS (The European Biology Open Software Suite, EMBnet, http://​www.​emboss.​org). Phylogenetic analyses Firstly, the phylogenetic relationship of the different types of repetitive element was estimated with a neighbour-joining analysis [26] based on the absolute number of base differences between the repeat element sequences (since this number is small, correction for multiple substitutions is not necessary). The resulting tree (Figure 3C) was used as the guide tree for manually adjusting the alignment of the repetitive elements (Figure 3B) in the alignment of the MLST sequences that include hctB. Secondly, the phylogeny of the 41 variants

of MLST targets was inferred using a Bayesian approach [e.g.', Adenosine triphosphate [27]]. The analysis was done with MrBayes 3.1.2, running under MPI [28]. A Bayesian analysis needs an explicit substitution model, and this was selected based on a hierarchical likelihood ratio test (ηLRT) approach [29] using Modeltest [30] together with PAUP* 4.0b10 [31]. MrBayes uses a Metropolis-coupled Markov chain Monte Carlo method to compute the posterior probabilities for the clades. This algorithm has no defined stop condition, but runs for a number of generations and must be monitored for convergence, and thus completion, of the algorithm. The convergence was assessed by monitoring the continuous-valued parameters using the software Tracer 1.4 [32], resulting in the Bayesian analysis being run for a total of 107 generations; the first 2.