In addition, nutritional factors such as reduced folic acid intake have been implicated [3, 13]. Several authors [4, 13, 22, 23] have BIIB057 established a direct relationship between regular physical exercise (PA) and a reduction in CVD risk, although the data regarding the effect of PA on plasma Hcy concentrations remain controversial because of methodological differences among different studies. Murakami et al. [13] noted that these

discrepancies may reflect differences in the methods used to evaluate PA, the lack quantitative information on training intensity or BMS202 chemical structure training time, and in some cases the lack of adjustment for folate intake status [4]. However, Venta et al. [14] suggested three possible mechanisms that may explain the increase in Hcy with increasing exercise intensity: increased free radical production [15], increases in methylated forms such as creatine and acetylcholine, and increases in the amino acid pool as a result of protein catabolism. The need for research in athletes who take part in different sports has been suggested to be important in order to account for the high prevalence of hyperchromocysteinemia [15]. To date, however, there have been no studies

that evaluated plasma Hcy levels while taking into account nutrient intakes, training intensity and training time, and rate of perceived exertion (RPE). Moreover, the relationship between PA and Hcy has not been studied in team sports such as handball, in which intermittent activity alternates with periods (-)-p-Bromotetramisole Oxalate of intense aerobic activity [24]. In the present study Selleckchem AZD3965 our aims were to evaluate macronutrient and folic acid nutritional status in high-performance athletes (handball players), and to determine the effect

on these parameters of training and a nutritional intervention based on dietary supplementation with folic acid. We analyzed the data in the light of training load and plasma Hcy concentrations. Methods Participants The study was done during the February to June 2010 sports season and all participants were members of the handball team (n = 14) sponsored by the Club Deportivo Puente Genil de Balonmano (Granada, Spain), in the Honor B Division of the Spanish professional handball league. The sample comprised 14 men (mean age 22.9 ± 2.7 years) who trained for a mean of 4 days per week in addition to competing in matches on weekends. Participation in the study was voluntary. None of the participants had evidence of CVD, diabetes or hypertension. All participants provided their informed consent in writing, and were given detailed information at the beginning and end of the study regarding the aims and procedures involved. The study was approved by the Research Ethics Committee of the University of Granada.

coli and S. Typhimurium recipients (Figure 2). This was in agreement with previous studies which have shown that the pil locus is required for conjugation in liquid [21, 27]. Removal of an rci recombinase, which allows the recombination of shufflon elements to determine

the terminal thin pilus protein and impacts on host specificity, has previously been shown to fix this region into one particular conformation [22]. Inactivation of the pCT rci gene resulted in a reduced transfer rate of pCT to the S. Typhimurium recipient, particularly in liquid learn more media, however there was no effect on the rate of transfer to the E. coli recipient (Figure 2). Therefore, we conclude that the thin pilus is not essential for pCT conjugation. However, the presence of the thin pilus consistently increased the frequency with which pCT conjugated into recipient host strains within liquid. It may be that production of the thin pilus provides better attachment of the GSK2126458 datasheet mating pair in liquid, and the active shufflon region allows variation and an extended pCT bacteria host range as shown in R64 [24]. As inactivation of pilS had no effect on pCT transfer on a filter to E. coli recipients, the role of the thin pilus Vistusertib datasheet in conjugation on a solid surface is less clear (Figure 2, Table 1). Figure 2 Conjugation frequencies of wild-type pCT and the pCT mutants on a solid surface (filled box) and in liquid (open box)

from bacterial donor E. coli DH5α to A) a S. Typhimurium recipient and B) an E. coli recipient. Inactivation of pCT genes had no detected effect on various bacterial hosts Inactivation of the six selected genes on pCT in each of the recombinant plasmids had no effect on bacterial host growth rates during mid-logarithmic phase or generation time of either host when compared to hosts containing wild-type pCT (Table 1). Apart from the inactivated parB, each mutant plasmid also remained in a 1:1 ratio when E. coli DH5α cells containing each mutant plasmid were

co-cultured in competition with E. coli DH5α containing wild-type pCT in-vitro. After approximately 80 generations, cells containing each mutant plasmid had a competition index indistinguishable from 1.0 (Table 1) indicating no fitness advantage or disadvantage over host cells containing wild-type pCT. Therefore, Leukocyte receptor tyrosine kinase inactivation of the five selected pCT gene regions had neither a beneficial or detrimental effect on host growth or on the host’s ability to compete in co-culture, suggesting these genes do not individually contribute or alleviate any significant burden the plasmid may place on the bacterial host cell under conditions tested. In contrast, the recombinant plasmid carrying the inactivated parB gene was out-competed by the wild-type pCT plasmid. The reason behind this phenomenon is unclear as the host cells carrying this recombinant plasmid exhibited no detectable growth defect.

Patients diagnosed with ‘indeterminate colitis’ were excluded from this study. All included patients were screened for vitamin D deficiency at the end of summer 2009 (September–November) and winter 2009–2010 (January–March) at the gastroenterology outpatient department of a large teaching hospital in the centre

of the Netherlands. Written informed consent was obtained from all participants. The study protocol was see more approved by the local Medical Ethics Committee of the Meander Medical Centre. Data collection A standardized questionnaire was used to analyse information on self-reported demographic data i.e. age, sex, ethnicity, health behaviour, physical activity, this website current smoking and alcohol usage. Physical activity was assessed using the SQUASH (Short QUestionnaire click here to ASess Health) questionnaire according to the national physical activity scale [12]. Excessive alcohol usage was defined as >21 alcoholic units per week for men and >14 alcoholic units per week for women. Disease activity of IBD was assessed by the Manitoba IBD index

[13]. This index is based on patient self-reports enclosing IBD-related symptoms in the last 6 months. Other patient characteristics were retrieved from documented medical records in order to obtain data of fractures in the past and corticosteroid usage. Body mass index was measured by calculating weight old in kilograms divided by the square height in meters. For their vitamin D assessment, patients had to undergo serum 25OHD measurement at the end of summer and winter and complete two questionnaires. In these questionnaires, patients were asked to report their daily oral vitamin

D supplementation (including daily dosages and type of supplementation i.e. prescription medication and/or over the counter supplements), medication compliance, preferred exposure to sunlight or shade when outdoors and average number of days per week with >2 midday hours exposure to sunlight during summer. Furthermore, sun holidays in the last 6 months, frequency of solarium visits, calcium intake (dairy products /day) and intake of fatty fish (servings/month), i.e. mackerel, herring and salmon, were assessed. Laboratory measurements Original serum samples were drawn in EDTA, respectively, heparin-containing collection tubes, centrifuged and stored at −30°C. Biochemical and haematological laboratory markers (e.g. haemoglobin (Hb), haematocrit (Ht), red blood cell distribution width (RDW), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), calcium, phosphate, alkaline phosphatase, albumin, creatinine and thyroid stimulating hormone) were measured at the end of summer (September–November 2009).

Purified DNA was cloned into the pGEM®-T-easy plasmid (Promega) and sequenced by Macrogen, in

Korea, using T7, M13R, and internal primers, as required. Three independent PCRs were sequenced for each gene, checked and confirmed for consistency. Partial sequences of the VNTR-105, VNTR-141 and the ANK genes WD0550 and WD0766 from different Wolbachia strains have been deposited GenBank database (Table 3). Table 2 this website List of primers designed according to the wMel genome sequence to amplify VNTRs and ANK genes. Locus/primer 5’ sequence Reference VNTR-141 for ggagtattattgatatgcg [30] VNTR-141 rev gactaaaggttagttgcat [30] VNTR-105 for gcaattgaaaatgtggtgcc [30] VNTR-105 rev atgacaccttacttaaccgtc [30] RO550F ggccaccatgggatcagaatttgaag [82] RO550R gatgacttatacgcagccccatag [82] RO766F gaccaccatgaaatatgacaaattt Temozolomide molecular weight [82] RO766R tcaagtaagtgctttttctgtc [82] Table 3 GenBank accession numbers for VNTR and ANK sequences. Strain VNTR-105 VNTR-141 WD0766 wMel JF797619 JF797613 NC_002978* wMelCS JF797618 JF797611 JF683428 wMelPop as wMelCS Selleck Vadimezan JF797612 JF683429

wRi n.d. n.d. NC_012416** wAu JF797617 JF797608 AY649753 wSan JN191623 JN191622 JF683435 wWil JF797616 JF797607 JF683433 wSpt JF797620 JF797609 JF683431 wPro n.d. JF797610 JF683430 wCer1 JF797615 JF797606 JF683434 wCer2 n.d. JF797614 JF683432 wHa n.d. n.d. JF683436 *wMel genome sequence **wRi genome sequence n.d. not determined Selection of size variable markers Polymorphic loci were previously identified from the sequenced genome of wMel of D. melanogaster ([41], GenBank reference sequence NC_002978) in silico by using Tandem Repeats Finder TRF (http://​tandem.​bu.​edu/​trf/​trf.​html) [51]. Two VNTR regions of interest, VNTR-105 and VNTR-141 were found to be polymorphic between different lines of D. melanogaster

[30]. The TRF PJ34 HCl analysis also detected more candidate loci, including some genes encoding ANK domain repeats that can also contain tandemly repeated DNA, and are hence candidate markers for MLVA. Genes encoding ANK domain repeats were previously annotated [41] and variability was found in supergroup A and B Wolbachia strains [36]. All of the tandem repeats analysed here were amplified by using primers designed for the conserved flanking regions (single copy coding genes) of the repeats within wMel. We further extended the TRF analysis to other completed Wolbachia genomes, wRi ([52] NC_012416), wPip ([53] NC_010981) and wBm ([54] NC_006833) in order to highlight the potential of MLVA for more distantly related Wolbachia strains in silico. The TRF analysis also included the genomes of Anaplasma marginale strain St. Maries (CP_000030) and Ehrlichia ruminantium strain Welgevonden (NC_005295) and Neorickettsia risticii strain Illinois (NC_013009), the closest relatives of the genus Wolbachia [55], as well as a comparison with free living Escherichia coli K12 substrain MG1655 (NC_000913). The bacterial genomes were analysed in the basic mode of TRF (version 4.

J Bone Miner Res 11:1218–1225PubMedCrossRef 13. Ma YL, Cain RL, Halladay DL, Yang X, Zeng Q, Miles RR, Chandrasekhar S, Martin TJ, Onyia JE (2001) Catabolic effects of continuous human PTH (1–38) in vivo is associated with sustained stimulation of RANKL and inhibition of osteoprotegerin and gene-associated bone formation. Endocrinology 142:4047–4054PubMed 14. Dietrich JW, Canalis EM, Maina DM, Raisz LG (1976) Hormonal

control of bone collagen synthesis in vitro: effects of parathyroid hormone and calcitonin. Endocrinology 98:943–949PubMedCrossRef 15. Isogai Y, Akatsu T, Ishizuya T, Yamaguchi A, Hori M, Takahashi N, Suda T (1996) Parathyroid hormone regulates osteoblast differentiation positively or negatively depending on the differentiation stages. J Bone Miner Res 11:1384–1393PubMedCrossRef 16. Bellows CG, Ishida H, Aubin JE, Heersche JN (1990) Parathyroid hormone reversibly suppresses the differentiation GKT137831 of osteoprogenitor cells into functional osteoblasts. Endocrinology 127:3111–3116PubMedCrossRef 17. Nishida S, Yamaguchi A, Tanizawa T, Endo N, Mashiba T, Uchiyama Y, Suda T, Yoshiki RO4929097 clinical trial S, Takahashi HE (1994) Increased bone formation by intermittent parathyroid hormone SGC-CBP30 chemical structure administration is due to the stimulation of proliferation and differentiation of osteoprogenitor cells in bone marrow. Bone 15:717–723PubMedCrossRef 18. Jilka RL, Weinstein RS, Bellido T, Roberson P, Parfitt AM, Manolagas SC (1999) Increased MRIP bone formation

by prevention of osteoblast apoptosis with parathyroid hormone. J Clin Invest 104:439–446PubMedCentralPubMedCrossRef 19. Tobimatsu T, Kaji H, Sowa H, Naito J, Canaff L, Hendy GN, Sugimoto T, Chihara K (2006) Parathyroid hormone increases beta-catenin levels through Smad3 in mouse osteoblastic cells. Endocrinology

147:2583–2590PubMedCrossRef 20. Fujita T, Inoue T, Morii H, Morita R, Norimatsu H, Orimo H, Takahashi HE, Yamamoto K, Fukunaga M (1999) Effect of an intermittent weekly dose of human parathyroid hormone (1–34) on osteoporosis: a randomized double-masked prospective study using three dose levels. Osteoporos Int 9:296–306PubMedCrossRef 21. Wang YH, Liu Y, Buhl K, Rowe DW (2005) Comparison of the action of transient and continuous PTH on primary osteoblast cultures expressing differentiation stage-specific GFP. J Bone Miner Res 20:5–14PubMedCrossRef 22. McClung MR, San Martin J, Miller PD, Civitelli R, Bandeira F, Omizo M, Donley DW, Dalsky GP, Eriksen EF (2005) Opposite bone remodeling effects of teriparatide and alendronate in increasing bone mass. Arch Intern Med 165:1762–1768PubMedCrossRef 23. Stepan JJ, Burr DB, Li J, Ma YL, Petto H, Sipos A, Dobnig H, Fahrleitner-Pammer A, Michalská D, Pavo I (2010) Histomorphometric changes by teriparatide in alendronate-pretreated women with osteoporosis. Osteoporos Int 21:2027–2036PubMedCrossRef 24. Rubin MR, Bilezikian JP (2003) The anabolic effects of parathyroid hormone therapy. Clin Geriatr Med 19:415–432PubMedCrossRef 25.

At the same time diffusion and flow have to be discriminated. These goals can best be obtained by the use of pulsed magnetic field gradient (PFG) techniques (for some background, see Van

As and Windt 2008). In this experiment, a sequence of two magnetic field gradient AZD1480 research buy pulses of duration δ and equal magnitude G but opposite sign (or equal sign but separated by an 180 rf pulse) label the protons as a function of their position. If the spins remain at exactly the same position check details the effect of the gradient pulses compensate each other. However, as soon as translation (displacement) motion occurs, the gradients do not exactly compensate each other anymore, resulting in selleck attenuation of the signal amplitude. The amount of this attenuation is determined by the length and amplitude of the gradient pulses, and by the mean translation distance traveled during the interval Δ between the two gradient pulses. In order to be able to discern flowing water from randomly diffusing water, Δ is typically varied from 15 ms for fast flowing xylem water, to 200 ms for slow moving phloem water (Scheenen et al. 2001). Linear displacement can be measured by stepping G of the pulsed field gradients –G max to +G max, as described previously by Scheenen et al. (2000a). After Fourier transformation of the signal

as a function of G, the complete distribution of displacements (i.e., flow profile) within Δ in the direction of the gradient is obtained for every pixel of an image. Such a displacement distribution is called a propagator. Making use of the fact that non-flowing (only diffusion) water results in a propagator that is symmetrical around zero, the signal in the non-flow direction can be mirrored around the displacement axis and subtracted from the signal in the flow direction to produce the flow profile of the flowing as well as the stationary water. The resulting flow profiles can then be used to Tobramycin calculate per pixel or in any selected area in

an image: the flow conducting area, the average velocity of the flowing water, and by taking the integral of the propagator of the flowing water, the volume flow (cf Fig. 3). Fig. 3 Example of combined water content (MSE) in one of the storage pools and flow measurements (PFG-TSE) in the stem of a 4 years old oak during a developing drought period, followed by rewatering (indicated by the line). Water content of the bark as (represented by the relative amplitude, the fraction of signal intensity with respect to that of pure water, averaged over all pixels in the mask of the bark as highlighted in the inserted image of the stem), the flow conducting area and volume flow in the active xylem (the xylem ring just inside the bark and the cambial zone).

Chem Eng Sci 2006,61(3):1027–1040.CrossRef 72. Shyh-Dar L, Song L, Leaf H: Lipoplex and LPD nanoparticles for in vivo gene delivery. Cold Spring Harb Protoc 2006,

2006:1.CrossRef 73. Qu X, Li P, Liu D, Liu C, Zhang N: Enhanced gene transfer with multilayered polyplexes assembled with layer-by-layer technique. IET Nanobiotechnol 2012,6(3):122–128.CrossRef Competing interests The authors declare that they have no conflicts of interests. Authors’ contributions SMD and SJ have made a significant contribution to the work or the drafting of the manuscript. AYK scientifically has revised and is the corresponding author of the manuscript. All authors read and approved the final manuscript.”
“Background One-dimensional CUDC-907 research buy silicon nanostructures, such as Si nanowires (NWs), nanorods (NRs), or nanopillar (NPs) have gained particular interests due to their special properties and potential applications

in electronic and optoelectronic devices [1–4]. Theoretical and experimental studies have reported that when arranged in a highly ordered fashion, Si NRs or NWs can improve light absorption and charge collection, making it possible to achieve high efficiency in solar cells buy PRN1371 [5–8]. Therefore, periodic Si NRs (or NWs) arrays have attracted considerable attentions in the fields of solar cells. However, despite the huge efforts to control and understand the growth mTOR inhibitor mechanisms underlying the formation of these nanostructures [9, 10], some fundamental properties and inside mechanisms are

still not well understood. To reveal their properties, the investigation on single NRs is preferred. Recently conductive scanning probe microscopy techniques have been attempted to investigate the electrical properties of single NWs/NRs. Among them, electrostatic force microscopy (EFM) can provide direct information of trapped carriers in single nanostructures and has been applied to investigate the charge trapping in single nanostructures, such as carbon nanotubes [11], pentacene monolayer islands [12], CdSe quantum dots (QDs) [13, 14], and etc. More recently, photoionization of QDs [15, 16] and photo-induced charging of photovoltaic films [17–19] have been studied by EFM combined with laser irradiation. But the photogenerated charging effects have not been concerned on Si NRs or NWs yet. In this letter, EFM measurements combined with laser Y-27632 clinical trial irradiation are applied to investigate the photogenerated charging properties on single vertically aligned Si NRs in periodic arrays. Methods Periodic arrays of Si NRs are fabricated by nanosphere lithography and metal-assisted chemical etching. Three samples (labeled as NR1, NR2, NR3) which contain periodic NR arrays with the same diameter of about 300 nm and different length or constructions are prepared. NR1 and NR2 are n-type Si (approximately 1,000 Ω cm) NRs with the length of about 0.5 and 1.0 μm, respectively, while NR3 is Si/SiGe/Si hetero-structural NRs with the length of 1.

A clinical study with oral squamous cell carcinomas shows that HLA class I expression is either weak or absent for not stimulation of CD8+ CTL, but there is still no a clear correlation of HLA class I expression loss with a relative proportion of NK cells, indicating that the local factors seem to down-regulate the final outcome of the cytotoxic immune response of NK cells [33]. Indeed, reduced expression of natural cytotoxicity GSK2118436 in vitro receptor, NKG2D ligand UL16 binding protein 1 and Inter-Cellular Adhesion Molecule 1 has been seen on tumor

cells [37, 38], which may specifically prevent NK cell activation. Non-classical HLA-G in inhibition of both CD8+ CTLs and NK cells HLA-G is a non-classical class I antigen, originally detected in trophoblastic cells [39], where it is proposed to suppress maternal immune response against the semi-allogeneic fetus. It binds to the inhibitory receptors Ig-like transcript (ILT) 2, ILT4 or KIR2DL4, resulting in suppression of cytotoxicity of both CD8+ CTL and NK cells [40, 41].

The protective role of HLA-G in carcinoma survival under immune surveillance is MK-0518 chemical structure demonstrated in many studies with patients; in contrast to its null expression in normal epithelial cells and benign adenomas, a high percentage (30-90%) of carcinoma cells expresses HLA-G in a variety of cancerous lesions, and its levels Rebamipide have been found to be significantly associated with clinicopathological features and shorter survival time JPH203 order of patients [42–45]. All these data indicate that carcinoma-expressing HLA-G could be one of important mechanisms for inhibition of both CD8+CTL and NK cell mediated anti-carcinoma immunity. Induction of TIC apoptosis by expression of pro-apoptotic ligands Fas ligand (FasL) FasL binding to death receptor Fas triggers

apoptosis of Fas-expressing cells including TICs. Two patterns of FasL expression on carcinoma cells have been shown by immunohistochemical staining: (1) up-regulation of FasL expression on carcinoma is positively associated with clinicopathological features in patients, shown by that FasL expression is an early event in epithelial cell transformation (adenoma), followed by an increase in the percentage of FasL-expressing carcinoma cells in high-stage or -grade lesions, and the poorer survival of patients with high levels of FasL expression (Table 2); and (2) high levels of FasL expression have been seen as an independent factor for clinicopathological features, indicated by the positive staining of persistent FasL expression regardless of tumor stage, histologic grade, invasion and metastasis in many studies [47, 58–61]. All of these observations suggest that FasL expression is critical for carcinoma survival by induction of TIC apoptosis.

In a pilot study of 15 patients with active PUB treated with this nanopowder, immediate hemostasis was achieved in 93%, and one patient had recurrent bleeding. No adverse events were reported during the follow-up. Further studies with this product are ongoing [123]. Early endoscopy (within 24 h) in PUB results in significantly reduction of the hospital stay and improvement of the outcome. Dual endoscopic therapy, rather than monotherapy, led to substantial reductions in rate of recurrent bleeding, surgery and mortality . Postendoscopic management Pharmacotherapy plays a second major

role in the treatment of PUB. PPIs can be administered orally or intravenously depending on the rebleeding risk. In a randomized placebo-controlled trial of 767 PUB patients treated with Selleck Entospletinib endoscopic therapy because of high-risk

stigmata, learn more high-dose intravenous PPIs (80 mg esomeprazole bolus plus 8 mg/h continuous infusion for 72 h) significantly reduced rebleeding (5.9% vs. 10.3%, P = 0.03) and the need for endoscopic retreatment [124]. Similar results were found by meta-analysis; high-dose intravenous PPIs after endoscopic therapy significantly reduced rebleeding, need for surgery and mortality compared with placebo/no therapy [125]. PPIs are recommended for 6–8 weeks following UGIB and/or endoscopic treatment of PUD to allow mucosal healing [126]. Once mucosal healing has been achieved, how long it should last the PPIs use is still controversial. Studies have shown that in patients who have PUD complicated by bleeding, Selleckchem Momelotinib there is a 33% risk of rebleeding in 1–2 years. Furthermore, there is a 40%-50% rebleeding risk over the subsequent 10 years following the initial episode of bleeding

[100]. Randomized prospective trials have demonstrated a benefit to long-term acid-suppression therapy in two settings: chronic NSAID users and H. pylori-infected patients [127]. Testing for H. pylori is recommended in all patients with PUB. This should be followed by eradication therapy for those who are H. pylori-positive, with subsequent assessment of the effect of this therapy, and renewed treatment in those in whom eradication Adenosine triphosphate fails [86]. High-dose continuous intravenous PPIs is recommended in patients with PUB and high-risk stigmata. Continued and recurrent bleeding Despite adequate initial endoscopic therapy, recurrent UGIB can occur in up to 24% of high-risk patients [98]. Mortality after a surgical salvage in the recent UK National Audit was 29% [128]. Large ulcers located in the posterior bulbar duodenum and lesser curvature of stomach can erode into the gastroduodenal or the left gastric artery, respectively, which are predictive of endoscopic treatment failure. These ulcers often occur in elderly patients who present with a major bleed in shock and low initial haemoglobin concentrations [129]. Patients with massive bleeding who do not respond to endoscopy are often shifted to surgical treatment.

An alternative approach would be to construct and test a parameter describing the degree of incompatibility (i.e. conflicting phylogenetic signals) between topologies. To the best of our knowledge, no such straightforward metric exists for this particular purpose of quantifying the level of incompatibility. Alternative topologies could be compared with a reference topology obtained from, e.g. the literature, a large set of concatenated genes or a source of high-quality whole-genome data. Ideally, such

reference topology should mimic the species phylogeny as accurate as possible. In this study, we evaluated the specificity of detection and classification of Francisella by first comparing published PCR primers against whole-genome sequences representing the known CDK inhibitor diversity of the genus. Second, we examined the sequence-marker robustness and resolution by comparing different sets of one to seven markers using a modified version of the RF metric. Finally, we showed that optimal sets of markers outperform other combinations with respect to phylogenetic robustness and resolution. Results Overall fit between DNA-markers and whole-genome sequences

of Francisella A total of 42 publicly available Francisella genome sequences were screened for sequences (Table 1) of 38 published markers (Table 2). 14 markers had incomplete sets of marker sequences (Figure 1). The lack of 16S marker sequences in FSC022, FSC033, MA002987, GA993549, and GA993548 was probably due to the low quality of the genome sequences, which were all sequenced with early versions of 454 sequencing Entospletinib ic50 technology. The lack of sequences for the remaining 10 markers was most likely because they were designed for real-time PCR molecular detection or possibly due to uncovered regions in the sequence (Additional file 1). Table 1 Genomes sequences included in the study Species ID BioProject ID F. tularensis subsp. YH25448 clinical trial holarctica FSC200 16087 F. tularensis subsp. holarctica FSC208 73467 F. tularensis subsp. holarctica RC503 30637 F. tularensis subsp. holarctica LVS 16421 F. tularensis subsp. holarctica FSC539 73393 F. tularensis subsp. holarctica

OR96-246 30669 F. tularensis subsp. holarctica FTA 20197 F. tularensis subsp. holarctica URFT1 19645 F. tularensis subsp. holarctica MI00-1730 30635 F. tularensis subsp. Cyclooxygenase (COX) holarctica OSU18 17265 F. tularensis subsp. holarctica FSC021 73369 F. tularensis subsp. holarctica FSC022 19015 F. tularensis subsp. mediasiatica FSC147 19571 F. tularensis subsp. mediasiatica FSC148 73379 F. tularensis subsp. tularensis FSC054 73375 F. tularensis subsp. tularensis ATCC6223 30629 F. tularensis subsp. tularensis FSC033 19017 F. tularensis subsp. tularensis MA00-2987 30443 F. tularensis subsp. tularensis FSC198 17375 F. tularensis subsp. tularensis SCHUS4 (FSC237) 9 F. novicida FTE 30119 F. novicida U112 16088 F. novicida FTG 30447 F. novicida GA99-3549 19019 F. novicida FSC160 73385 F. novicida FSC159 73383 F.