[23, 24] The cosmid pAxCALNLwtit2 additionally contains Cre/LoxP site by which DsRed-FUS is expressed by co-infection with AxCANCre encoding bacterial Cre recombinase (TaKaRa). In our

hands, adenoviruses encoding DsRed-FUS were produced much more efficiently by using pAxCALNLwtit2 as compared to pAxCAwtit2, putatively due to cytotoxicity of overexpressed FUS protein in 293 cells during adenovirus production as described below. For the construction of adenoviruses encoding shRNAs and EGFP, 19–21 nucleotide sequences for rat negative control (NC; GGAATCTCATTCGATGCATAC), PSMC1 (NM_057123; CGATGATAATCACGCCATTGT), ATG5 (NM_001014250; GATGGGACTGCAGAATGAT), and VPS24 (NM_172331; GAAGCAGCAGAAATGGAGATT) shRNA sequences XL765 datasheet (SA Biosciences, ATM/ATR phosphorylation Frederick,

MD, USA) were cloned into pGeneClip hMGFP vector under U1 promoter (Promega, Madison, WI, USA) in which hMGFP fragment was replaced by EGFP fragment to enable detection by Western blot using conventional green fluorescent protein (GFP) antibodies. The resulting U1-shRNA/CMV-EGFP fragments were subcloned into Swa I cloning site of a cassette cosmid pAxcwit (TaKaRa). The cosmids were then transfected to 293 cells and recombinant adenovirus vectors encoding DsRed-tagged wild type (AxDsR-WT.TDP43), CTF (AxDsR-CTF.TDP43), and mutated (AxDsR-G294A.TDP43, AxDsR-G298S.TDP43, AxDsR-A315T.TDP43 and AxDsR-Q343R.TDP43) TDP-43, DsRed-tagged wild type Erythromycin (AxLDsR-WT.FUS) and mutated (AxLDsR-R521C.FUS, AxLDsR.R521G.FUS, AxLDsR.R522G.FUS

and AxLDsR.P525L.FUS) FUS, and shRNAs for negative control (NC), PSMC1, ATG5, and VPS24 coupled with EGFP (AxshNC/EGFP, AxshPSMC1/EGFP, AxshATG5/EGFP and AxshVPS24/EGFP, respectively), were propagated and isolated from 293 cells, and purified by ViraBind Adenovirus Purification Kit (Cell Biolabs, Inc., San Diego, CA, USA) (Fig. 1). COS7 cells were infected with adenoviruses encoding DsRed-tagged wild type, CTF, and mutated TDP-43, or wild type and mutated FUS at a multiplicity of infection (moi) of 100, and DsRed expression was examined under an Olympus IX70 inverted fluorescence microscope equipped with a DP72 charge-coupled device (CCD) camera. To confirm the inhibition of target molecule expression by shRNA adenoviruses, COS7 cells were transfected with rat full length PSMC1, ATG5, or VPS24-expressing pDsRed-Monomer-C1 plasmid, that had been prepared by RT-PCR and subsequent cloning, using Fugene 6 transfection reagent (Promega) according to the manufacturer’s instructions. The cells were then infected with AxshNC/EGFP, AxshPSMC1/EGFP, AxshATG5/EGFP or AxshVPS24/EGFP at a moi of 100. Depletion of target DsRed fluorescence induced by appropriate shRNA expression in the transfected/infected COS7 cells was checked under the fluorescence microscope.