Reverse-transcriptase PCR analysis Total RNA were isolated from cultured cells or tumor samples by using Trizol

(Invitrogen, USA) according to the manufacturer’s instruction. Complementary DNA (cDNA) was synthesized by reverse transcription of 1 μg RNA samples with SuperScript pre-amplification system (Promega, Madison, MI). One tenth of the reverse transcribed RNA was used in PCR reaction. The primer sequences were as follows: GAPDH forward 5′ – GAAGGTGAAGGTCGGAGTC-3′ and reverse 5′- GAAGATGGTGATGGGATTTC′ (product 300 bp); Ku80 forward 5′-ACGATTTGGTACAGATGGCACT−3′ and reverse 5′-GCTCCTTGAAGACGCACAGTTT −3′ (product 497 bp). RT-PCR products were separated by electrophoresis on 1.5% agarose this website gel containing ethidium bromide. Western blot analysis Total protein was isolated from culture cells or tumor samples and subjected to western blotting analysis as previously described [20]. Equal amounts of protein (40 μg) as determined by the Protein Assay Kit (Bio-Rad, Hercules, CA) was separated by 12% PAGE and transferred onto nitrocellulose membranes (Millipore, Bedford, MA). The membranes were blocked with 5% nonfat milk diluted in buffer (10 mM Tris–HCl, 100 mM NaCl and 0.1% Tween 20) for 1 h at room temperature. The membranes were then incubated with primary antibodies at 1: 1000 dilution for Ku80, cleaved-PARP, cleaved-Caspase 3, or β-actin (Abcam,

MA, USA), followed

by incubation with Horseradish peroxidase-conjugated secondary antibodies (Thermo, Waltham, USA) at 1: 2000 Sorafenib chemical structure dilution for 1 h at room temperature. The protein bands were detected by an enhanced chemiluminescene kit (Pierce, Rockford, USA). Protein levels were quantified by densitometry using Quantity One software (Bio-Rad). Statistical analysis The data were presented as mean ± standard deviation. All statistical analysis was performed using SPSS.17.0 software (SPSS, Chicago, IL, USA). The paired-samples Wilcoxon signed rank Interleukin-3 receptor test was used to compare the expression of Ku80 between tumor and adjacent normal tissues. A 2-fold difference between control and test was considered the cut-off point to define high or low expression. Comparisons between treatments were made using one-way ANOVA for multiple group comparisons and differences between treatments were examined with a Tukey test. The correlation between Ku80 expression and clinic pathologic features was examined using the Pearson’s Chi-squared test. Overall survival and progression-free survival were calculated using the Kaplan–Meier method and log-rank tests. A 2-tailed P value of less than 0.05 was defined as statistical significance. Results Ku80 is overexpressed in lung adenocarcinoma tissues First we examined mRNA and protein expression of Ku80 in 106 pairs of snap-frozen lung adenocarcinoma and adjacent nonmalignant lung tissues.